search for




 

Effect of Indirubin on Morphology Changes and mRNA Expression of Cytokines in LPS-induced RAW264.7
Yakhak Hoeji 2023;67(1):51-57
Published online February 28, 2023
© 2023 The Pharmaceutical Society of Korea.

Ye Jin Hwang* and Jae Seon Kang*,#

*College of pharmacy, Kyungsung University
Correspondence to: Jae Seon Kang, College of Pharmacy, Kyungsung University 309, Suyeong-ro, Nam-gu, Busan, Korea
Tel: +82-51-663-4882, Fax: +82-51-663-4809
E-mail: jskang28@hanmail.net
Received December 16, 2022; Revised February 1, 2023; Accepted February 27, 2023.
Abstract
This study was conducted to investigate the regulatory effect of Indirubin on LPS-induced inflammation in macrophage. The morphologic changes were shown as widened cytoplasm or biased nucleus from the center of the cell when LPS activated macrophage. The changes in inflammation activity were also estimated with mRNA levels of cytokines under time elapse at 2, 4, 8, 12, and 24 hours after the 10 ng/mL LPS treatment. By measuring those pro-inflammatory (TNF-α, IL-1β) and anti-inflammatory (IL-10) cytokines at each time set, the relationship between morphologic change and inflammation activity was compared. The highest pro-inflammatory mRNA expression was observed at 2 hours after the LPS treatment, and this was inhibited by those Indirubin standard (Indirubin) and Chungdae extract (CDEX). The mRNA expression level in LPS treated cell was markedly reduced at 8 hours as well as the other groups. However, IL-10, the anti-inflammatory cytokines was not affected by those treatments. The results suggested that the level of inflammation related changes as time elapsed. The current observation that both Indirubin and CDEX are able to inhibit LPS-induced inflammation by reducing the production of inflammatory cytokines. Moreover, the current observation suggested that estimating anti-inflammatory effects should include time-dependent measurements as biomarkers.
Keywords : Chungdae, Indirubin, Inflammation, Macrophage, Morphology, mRNA, Time-dependent manner
Introduction

Chungdae (Polygonum tinctorium Ait, P. tinctorium) powder is obtained by fermenting Polygonum indigo or treating with lime. It is known to be mainly effective in anti-neuro inflammatory, anti-cancer, and nociception. Indirubin, a Chungdae component, is an isomer of indigo. Indirubin is a chemical compound, most of which is produced as a by-product of botanical and bacterial metabolism.1) It is widely used in traditional Chinese medicine for the treatment of inflammation, and chronic disease and is known for good efficiency and very low side effects.2) It improves nitric oxide (NO) production and inhibits the activation of nuclear factor-κB (NF-κB) which mediates inflammatory reactions.3) Downregulation of pro-inflammatory cytokines either in acute and chronic inflammation by Indirubin was also reported.4)

Rhinitis is a disease that shows symptoms of sneezing, itching, nasal secretion, and nasal congestion due to inflammation of the nasal mucosa,5) and has been knowns to be caused by various allergic and non-allergic mechanisms.6) Allergic rhinitis is known to be related to hypersensitivity of immunity that is mediated by the reaction of immunoglobulin E (Ig E).7) In the case of non-allergenic rhinitis, it is a reaction not mediated by Ig E, but it characterizes symptoms of rhinitis.6) Non-allergic rhinitis is generally known as chronic inflammation, which it has occurred when rhinitis persists for a long time due to tonsillitis or repeated sinusitis,8) and macrophages are involved in such chronic inflammation.9)

Macrophage is a type of white blood cell differentiated from the bone marrow`s hematopoietic stem cell (HSC). It is a crucial cell component that has a defense against pathogens such as inflammation and microorganisms.10) Macrophage has some effects on innate immunity by secreting both pro-inflammatory and anti-inflammatory cytokines. 10) It also plays an important role in initiating non-specific defense mechanisms (innate immunity) and specific defense mechanisms (adaptive immunity) through interaction with other immune cells such as lymphocytes.10) Macrophage ingest and degrade dead cells, tumor cells, and foreign materials. They promote homeostasis by responding to internal and external changes within the body, not only as phagocytes, but also through regulatory, restore, and repair functions.10) Macrophage is polarized into M1 macrophage or M2 macrophage, and M1 Macrophage is involved in pro-inflammatory and high production of IL-1β, TNF-α, and IL-6, but low production of IL-10 and M2 macrophage is involved in anti-inflammatory and high production of IL-10.11) Due to these differences in cytokines, M1 macrophage play a central role in host defense against infection, and M2 macrophage is involved in tissue repair.12)

Recently, the possibility that indirubin has a symptom improving effect on rhinitis has been raised. Rhinitis is mainly caused by allergies (Hypersensitivity) and chronic inflammation.

It is known that macrophage is mainly involved in inflammation. According to a with RAW264.7 In vitro, those levels in cytokines of M1 and M2 macrophage state were alternated in a time-dependent manner.13,14) Therefore, the current study investigated the anti-inflammatory effect of Indirubin on LPS-induced inflammation in RAW264.7 including macrophage stage and time-related interaction estimated in morphology and cytokines expressions in the cell.

Methods

Preparation of Chungdae extract containing Indirubin

10 g of Chungdae powder was dissolved in 100 mL of acetic acid, glacial and then the filtration process was carried out using filter paper. Then, add an additional 15 mL of acetic acid, glacial on the filter paper to extract the remaining ingredients in the Chungdae powder as much as possible. After filtration was completed, the process of suspension in Distilled water (D.W) 1 L was carried out. After the suspension process, centrifugation was performed at 10,000 rpm {Labogene-Scanspeed 1736 R with rotor GRF-250-6 (6×250 mL)} and 20 minutes to collect the Indirubin precipitated in D.W. Then the pellet was collected and dissolved in 60 mL of 95% ethanol, and then further centrifuged at 10,000 rpm and 10 minutes for further purification to collect only the supernatant.

Cell culture and treatment

RAW264.7 (ATCC® TIB-71TM) were grown in Dulbecco’s Modified Eagle Medium (DMEM, GIBCOTM, NY, USA) supplemented with 10% Fetal bovine serum (FBS, GIBCOTM, NY, USA) and 1% penicillin/streptomycin (GIBCOTM, USA).

RAW264.7 was incubated at 5% CO2 at 37 °C.

Cell cytotoxicity

To confirm the cell viability under Indirubin exposure, the MTT assay of Indirubin standard (Indirubin) and Chungdae extract (CDEX) was conducted. The Indirubin concentration was set at 0.1, 0.25, 0.5, 0.75, and 1 μM. RAW264.7 cells (1×104 cells/well) were seeded on a 96-well plate for 16 hours. Afterwards, it was treated by concentration, treated with an MTT reagent (Cell Counting Kit-8, USA) 24 hours later. After 4 hours and 30 minutes, absorbance was measured at 450 nm with a microplate reader (Varioskan LUX Multimode Microplate Reader/Molecular Devices, USA).

Identification of morphologic changes in LPS-induced RAW264.7

RAW264.7 cells (1×104 cells/well) were seeded on a 96-well plate. After 24 hours of stabilization, Lipopolysaccharide (LPS) 10 ng/mL was treated alone, LPS 10 ng/mL and Indirubin 0.1 μM were treated simultaneously, and LPS 10 ng/mL and CDEX 0.1 μM were treated simultaneously. The morphology was compared immediately before, immediately after, and after treatment for 2, 4, 8, 12, and 24 hours to confirm the change in the difference in a time-dependent manner.

Identification of gene expression in LPS-induced RAW264.7

RAW264.7 cells (1×105 cells/well) were seeded on a 24-well plate for 24 hours. After incubation, LPS 10 ng/mL was treated alone, LPS 10 ng/mL and Indirubin 0.1 μM were treated simultaneously, and LPS 10 ng/mL and CDEX 0.1 μM were treated simultaneously. The reaction was performed for 2, 4, 8, 12, and 24 hours, and then RNA extraction was performed by washing Trizol. After 10 minutes of reaction with chloroform, centrifugation was performed at 13,200 rpm {Eppendorf - Centrifuge 5804 R with rotor FA-45-30-11 (30×1.5/2 mL)} for 15 minutes. Isopropanol was added for RNA precipitation. Pellet was washed with 75% ethanol. Ethanol was removed and dried at room temperature for 5 minutes. When ethanol is completely removed. Then, it is suspended in Dnase-free D.W and heated at 55°C for 10 minutes. After that, it is stored frozen at –70°C. The total quantified RNA was then performed real-time PCR by the method of Two-step qRT-PCR(RT-PCR→real-time PCR). A kit containing 5x cDNA synthesis Mix was used and RNA performed qPCR using 42TM Design & Analysis software.

Sequence of M1 macrophage primers for quantitative PCR

Target PCR primer sequence 5'→3'
IL-1β Forward - TGGACCTTCCAGGATGAGGACA
Reverse - GTTCATCTCGGAGCCTGTAGTG
TNF-α Forward - GGTGCCTATGTCTCAGCCTCTT
Reverse - GCCATAGAACTGATGAGAGGGAG
GAPDH Forward - AACTTTGGCATTGTGGAAGG
Reverse - ACACATTGGGGGTAGGAACA

Among the Pro-inflammatory cytokines of M1 macrophages, mRNA expression was confirmed by qPCR using mRNA of TNF-α and IL-1β. GAPDH was used as the house keeping gene.



Statistical analysis

The experimental results were performed in three replicates, the data was displayed as mean±SD, and the results of the Indirubin, the cell viability of the CDEX, and the mRNA of the cytokines were summarized in a bar chart through GraphPad Prism 5. The statistical analysis was tested for significance with Student's t-test or ANOVA. The significance between each group was adopted by post hoc analysis (Dunnett's t-test) and the p<0.05, and marked with ‘*’ on the graph.

Results

RAW264.7 Maximum treatment concentration measure-ment by concentration Indirubin treatment

To determine the concentration of Indirubin to be used in this study, an MTT assay was conducted to confirm cell damage in RAW264.7 used in the experiment. As a result of the measurement, when Indirubin was treated at a concentration in the range of 0.1~1 μM in RAW264.7, there was cell damage at 0.75 μM on more in the case of Indirubin (Fig. 1).



Fig. 1. Cytotoxic effect of Indirubin on RAW264.7. A range of 0.1~1 μM Indirubin was tested in RAW264.7, and cell viability was measured by MTT assay. The data are represented as percentile values of control. Each measurement was conducted in triplicate. The bar represents means±SD. Significant differences are indicated with ‘*’ at p<0.05 compared with a normal control group. Control: Normal control group, 0.1 μM: Indirubin concentration 0.1 μM group, 0.25 μM: Indirubin concentration 0.25 μM group, 0.5 μM: Indirubin concentration 0.5 μM group, 0.75 μM: Indirubin concentration 0.75 μM group, 1 μM: Indirubin concentration 1 μM group. *Indirubin= Indirubin standard

In the case of CDEX, it was confirmed that it did not affect cell damage (Fig. 2). In studies by Manoela Viar Fogaca et al. with Indirubin, there was no toxicity at concentrations below 5 μM.15) In another studies by Jin-Lun Lai et al. with Indirubin, there was no toxicity at concentration of 0.1~0.025 μM.4) In a study using Indirubin, it was confirmed that the 0.1 μM to be performed in this experiment did not affect cell damage when treated with RAW264.7.



Fig. 2. Cytotoxic effect of CDEX on RAW264.7. A range of 0.1~1 μM CDEX was tested in RAW264.7, and cell viability was measured by MTT assay. The data are represented as percentile values of control. Each measurement was conducted in triplicate. The bar represents means±SD. Significant differences are indicated with ‘*’ at p<0.05 compared with a normal control group. Control: Normal control group, 0.1 μM: Indirubin concentration 0.1 μM group, 0.25 μM: Indirubin concentration 0.25 μM group, 0.5 μM: Indirubin concentration 0.5 μM group, 0.75 μM: Indirubin concentration 0.75 μM group, 1 μM: Indirubin concentration 1 μM group. *CDEX=Chungdae extract

Verification of morphology of RAW264.7 activated with LPS

Indirubin and CDEX were compared in RAW264.7 treated with LPS 10 ng/mL by simultaneously treating the concentration of 0.1 μM and LPS. In the RAW264.7 group, which treated only 10 ng/mL of LPS, nuclear migration and cytoplasmic widening were observed for 2 hours and Cell shape changed at 4 hours. Cell proliferation was observed at 24 hours (Fig. 3). In RAW264.7 treated with Indirubin 0.1 μM, nuclear migration and cytoplasmic widening were observed at 2 hours, cell shape changes at 8 hours, and cell proliferation at 12 hours (Fig. 3). In RAW264.7, which was treated with 0.1 μM of CDEX, it was observed that the cell shape was maintained for up to 4 hours. The number of cells increased after the cell shape changed at 8 hours. Morphology change comparison showed that CDEX had longer cell shape retention and suppressed the activity level of RAW264.7 compared to LPS only and Indirubin treatments.



Fig. 3. Indirubin effect on RAW264.7 shape treated with LPS 10 ng/mL. Shown pictures are morphologic changes of RAW264.7 (1×104 cells/well) with only LPS (10 ng/mL) or LPS and each substance for 24 hours. LPS is nuclear migration and cytoplasm broadening was observed in RAW264.7 in 2 hours. At 4 hours observe changes in the cell shape. Cell proliferation observation at 24 hours. Indi rubin is nuclear migration and cytoplasm broadening was observed in RAW264.7 in 2 hours. At 8 hours, observe changes in cell shape. Cell prolife ration observation at 12 hours. CDEX observed that the cell shape was maintained for up to 4 hours, and an increase in the number of c ells was confirmed as the cell shape changed at 8 hours. Before: Before LPS treated, 0 hour: Immediate substance treated, 2 hours: 2 hours after substance treated, 4 hours: 4 hours after substance treated, 8 hours: 8 hours after substance treated, 12 hours: 12 hours after substance treated, 24 hours: 24 hours after substance treated. *LPS=LPS group, Indirubin=Indirubin standard, CDEX=Chungdae extract

Measurement of mRNA change in RAW264.7 activated with LPS

The value of qPCR was calculated by delta delta CT.

The level of mRNA in RAW264.7 was confirmed through qRT-PCR to confirm the inhibitory effect of the Indirubin and CDEX. As a result, it was confirmed that the expression inhibition amount of TNF-α mRNA was high in the order of the CDEX, Indirubin, and LPS (Fig. 4). It was confirmed that the expression inhibition of IL-1 mRNA was increased with the Indirubin, CDEX, and LPS (Fig. 5).



Fig. 5. Relative IL-β mRNA expression level in RAW264.7. Shown represents Relative IL-1β mRNA expression belonging to Proinflammatory cytokines time elapse. 0 hour: IL-1β expression in 0 hour, 2 hours: IL-1β expression in 2 hours, 4 hours: IL-1β expression in 4 hours, 8 hours: IL-1β expression in 8 hours, 12 hours: IL-1β expression in 12 hours, 24 hours: IL-1β expression in 24 hours. *LPS=LPS group, Indirubin=Indirubin standard, CDEX=Chungdae extract
Discussion

Based on the results described in this study, we confirmed the correlation between morphology changes and mRNA expression volume.

First, when comparing changes in morphology, V. Malheiro et al. observed that THP-1, a human macrophage, was stimulated with 100 ng/mL of LPS and 20 ng/mL of IFN-γ, and an additional IL-4 was incubated with 20 ng/mL for M2 macrophage. In the case of the M1 macrophage, a change in the shape of the cytoplasm occurred, and in the case of the M2 macrophage, the cytoplasm was enlarged as a whole.16) RAW264.7, a mouse macrophage, was observed after stimulation with LPS 10 ng/mL. LPS and Indirubin were converted to M2 macrophage, which widens the cytoplasm after 2 hours. In the case of CDEX, the conversion to M1 macrophage and M2 macrophage was relatively slow due to cytoplasm changes at 8 hours. In addition, the morphological difference between the M1 macrophage and the M2 macrophage is believed to be due to the interspecific difference between THP-1, and RAW264.7 the difference between the treated LPS alone and the Indirubin and the CDEX. In the study of Karen C. Wheeler et al., THP-1 was incubated with LPS 100 ng/mL and IFN-γ 20 ng/mL for 48 hours and polarized with M1 macrophage, and further incubated with IL-4 100 ng/mL for 48 hours to polarize with M2 macrophage. Although morphology was not identified by time period, the characteristic morphology of the M2 macrophage and M1 macrophage was described. According to the results of the study, the cytoplasm widened as the M1 macrophage flattened, and the cell itself lengthened in the case of the M2 macrophage.17) When compared with this experiment, it was confirmed that the cell shape was generally round and only the cytoplasm was wide when checked for up to 24 hours. These differences also between the species of human macrophage and mouse macrophage, but this experiment used only LPS, while the studies of Karen C. Wheeler et al. and V. In the study of Malheiro et al., there was a difference in the use of IFN-γ and IL-4. The morphology of the M1 macrophage, is more pronounced than in this experiment by giving both LPS and IFN-γ, and IL-4 is known to be a stimulator of M2 macrophage. In the study of Shuxia Wang et al., RAW264.7 as in this experiment, was observed by stimulation with LPS 10 ng/mL and IFN-γ 20 ng/mL, and in the case of M2 macrophage, IL-4 was additionally cultured with 20 ng/mL. Studies by Shuxia Wang et al. confirmed that unlike human macrophages, M1 macrophages had a long shape, and M2 macrophages returned to their original shape.18) This difference in morphology can be seen as a difference between species. Compared with this experiment. The M1 macrophage did not stimulate additional IFN-γ, so this experiment only widened the cytoplasm, At the same time, Shuxia Wang et al. showed a difference in the length of the cell itself. In the case of M2 macrophage, IL-4 stimulation is not essential because the morphology of M2 macrophage appeared circular after 24 hours, as in Shuxia Wang et al. even though IL-4 was not treated in this experiment.

When comparing the changes in mRNA, In the case of TNF-α mRNA, Estelle A. Wall et al. first showed the highest expression of TNF-α mRNA in 4 hours when LPS 100 ng/mL was treated in RAW264.7.19) In the case of studies such as Mei-Jen Wang, when 1 μg/mL of LPS was treated in RAW264.7, the expression amount of TNF-α mRNA was the highest in the 1 hour.20) Compared to this experiment and Estelle A. Wall et al., the TNF-α mRNA expression time was delayed due to an increase in LPS concentration, but compared to Mei-Jen Wang et al., TNF-α mRNA was higher in a faster time, so it is considered to promote macrophage etching when treated with many cells and high concentration of LPS. In the case of IL-1β mRNA, this experiment showed the highest expression in 2 hours, but in a study by Kai Wang et al., when 1 μg/mL of LPS was treated with RAW264.7 was the highest expression in 6 hours.21) In this experiment, when comparing studies by Kai Wang, etc., it is considered that the conversion to M2 becomes slower as the phagocytosis of M1 macrophage increases when the LPS concentration increases in the same cell number. In the case of IL-10 mRNA, in a study by Estelle A. Wall et al., when 100 ng/mL of LPS was treated with RAW264.7, the expression of TNF-α mRNA was the highest in 4 hours, unlike this experiment.19) In a study by Hugues Chanteuxe et al., HAM, a human alveolar macrophage, had the highest expression at about 16 hours when treated with 1 μg/mL of LPS.22) Since Human has a slower metabolic rate than Mouse, it is considered that the expression time zone is different due to the differences in species.

In this experiment, we did not confirm protein expression, but we wanted to confirm morphological changes according to the amount of mRNA expression. When compared with the time zone of Morphology and mRNA, the expression of TNF-α mRNA was most suppressed in the case of CDEX (Fig. 4). As a result of confirming with the morphology, TNF-α seems to affect cell shape change (Fig. 3). In addition, Indirubin and CDEX inhibit inflammatory active substances. Still, Indirubin suppresses the expression of IL-1β mRNA (Fig. 5) the most. CDEX suppresses the expression of TNF-α mRNA (Fig. 4). However, it is difficult to explain the comparison of overall morphology changes by the expression amount of mRNA, so it seems that additional protein expression confirmation is needed.



Fig. 4. Relative TNF-α mRNA expression level in RAW264.7. Shown represents Relative TNF-α mRNA expression belonging to Pro-inflammatory cytokines time elapse. 0 hour: TNF-α expression in 0 hour, 2 hours: TNF-α expression in 2 hours, 4 hours: TNF-α expression in 4 hours, 8 hours: TNF-α expression in 8 hours, 12 hours: TNF-α expression in 12 hours, 24 hours: TNF-α expression in 24 hours. *LPS=LPS group, Indirubin=Indirubin standard, CDEX=Chungdae extract

In addition, in this experiment, the amount of change in mRNA was confirmed by time zone, and in studies such as those by Xuan Luo and Zhiying Ru, the anti-inflammatory effect was confirmed by specific time zones after treating RAW264.7 with LPS 100 ng/mL.23)24) It was confirmed that inflammatory substances were suppressed compared to the LPS group at a specific time, but when it was confirmed in the overall time zone as in this experiment, it was confirmed that the mRNA expression was significantly different in 2 hours. However, in the case of time, the difference in effect is not significant, and rather, it can be seen that there is no difference in effect from 12 hours, so it is considered difficult to judge the overall anti-inflammatory effect at a specific time. In this experiment, the expression amount of IL-10 mRNA was confirmed together, but in the case of IL-10 mRNA, there was no significant difference, so additional experiments will be conducted later.

Those LPS-induced inflammation models with macrophage generally involve test material effects on biomarkers cytokines change at a single time point only. Thus the actual effects on the regulation of inflammation might not be estimated. The current observation suggested that Indirubin could be able to regulate (or inhibit) the inflammation by regulating either cytokines production or overall reaction time span. As in this experiment, when the overall time zone as well as a specific time zone is checked, the overall trend of active inflammatory materials can be identified by time zone. Through this, it is possible to determine whether the substance to be identified ends the inflammatory reaction with faster inflammation or if it is effective in anti-inflammatory by lowering the inflammation to a level below the threshold, so it is considered reasonable to check the overall time frame

Conclusion

Indirubin is effective against anti-inflammatory and time-dependent cytokines of LPS-induced macrophages, confirming the mechanism of regulation of macrophages by Indirubin. As a result, treated LPS-activated macrophages with Indirubin and CDEX showed an overall inflammatory inhibitory effect, and morphology, mRNA, and cytokines showed that Indirubin and CDEX inhibit inflammatory activity by inhibiting different cytokines. Based on the results of this study, Indirubin is used to indicate the possibility of improving the effectiveness of rhinitis due to chronic inflammation.

Acknowledgment

This research was supported by Kyungsung University Research Grants in 2020.

Conflict of Interest

All authors declare that they have no conflict of interest.

References
  1. Agbanoma G, Li C, Ennis D, Palfreeman AC, Williams LM, Brennan FM (2012) Production of TNF-α in macrophages activated by T cells, compared with lipopolysaccharide, uses distinct IL-10-dependent regulatory mechanism. Journal of Immunology 188(3):1307-1317.
    Pubmed CrossRef
  2. Ando M, Tu W, Nishijima K, Iijima S (2008) Siglec-9 enhances IL-10 production in macrophages via tyrosine-based motifs. Biochemical and Biophysical Research Communications 369(3): 878-883.
    Pubmed CrossRef
  3. Chanteux H, Guisset AC, Pilette C, Sibille Y (2007) LPS induces IL-10 production by human alveolar macrophages via MAPKinases-and Sp1-dependent mechanisms. Respiratory Research 8(1): 71.
    Pubmed KoreaMed CrossRef
  4. Eifan AO, Durham SR (2016) Pathogenesis of rhinitis. Clinical and experimental allergy. Journal of the British Society for Allergy and Clinical Immunology 46(9): 1139-1151.
    Pubmed CrossRef
  5. Fogaça MV, Cândido-Bacani PM, Benicio LM, Zapata LM, Cardoso PF, de Oliveira MT, Calvo TR, Varanda EA, Vilegas W, de Syllos Cólus IM (2017) Effects of indirubin and isatin on cell viability, mutagenicity, genotoxicity and BAX/ERCC1 gene expression. Pharmaceutical Biology 55(1): 2005-2014.
    Pubmed KoreaMed CrossRef
  6. Hirayama D, Iida T, Nakase H (2017) The Phagocytic Function of Macrophage-Enforcing Innate Immunity and Tissue Homeostasis. International Journal of Molecular Sciences 19(1): 92.
    Pubmed KoreaMed CrossRef
  7. Lai JL, Liu YH, Liu C, Qi MP, Liu RN, Zhu XF, Zhou QG, Chen YY, Guo AZ, Hu CM (2017) Indirubin Inhibits LPS-Induced Inflammation via TLR4 Abrogation Mediated by the NF-kB and MAPK Signaling Pathways. Inflammation 40(1): 1-12.
    Pubmed CrossRef
  8. Liu YC, Zou XB, Chai YF, Yao YM (2014) Macrophage polarization in inflammatory diseases. International Journal of Biological Sciences 10(5): 520-529.
    Pubmed KoreaMed CrossRef
  9. Luo X, Zhang H, Wei X, Shi M, Fan P, Xie W, Zhang Y, Xu N (2018) Aloin Suppresses Lipopolysaccharide-Induced Inflammatory Response and Apoptosis by Inhibiting the Activation of NF-κB. Molecules 23(3): 517.
    Pubmed KoreaMed CrossRef
  10. Malheiro V, Lehner F, Dinca V, Hoffmann P, Maniura-Weber K (2016) Convex and concave micro-structured silicone controls the shape, but not the polarization state of human macrophages. Biomaterials Science 4(11): 1562-1573.
    Pubmed CrossRef
  11. Mantovani A, Sica A, Sozzani S, Allavena P, Vecchi A, Locati M (2004) The chemokine system in diverse forms of macrophage activation and polarization. Trends in Immunology 25(12): 677-686.
    Pubmed CrossRef
  12. Min YG, Lee KS (2000) The role of cytokines in rhinosinusitis. Journal of Korean Medical Science 15(3): 255-259.
    Pubmed KoreaMed CrossRef
  13. Oishi Y, Manabe I (2016) Macrophages in age-related chronic inflammatory diseases. NPJ Aging and Mechanisms of Disease 2: 16018.
    Pubmed KoreaMed CrossRef
  14. Pahwa R, Goyal A, Jialal I (2022) Chronic Inflammation. In StatPearls. StatPearls Publishing.
  15. Qi T, Li H, Li S (2017) Indirubin improves antioxidant and anti-inflammatory functions in lipopolysaccharide-challenged mice. Oncotarget 8(22): 36658-36663.
    Pubmed KoreaMed CrossRef
  16. Ru Z, Xu M, Zhu G, Tu Y, Jiang Y, Du H (2021) Ovotransferrin exerts bidirectional immunomodulatory activities via TLR4-mediated signal transduction pathways in RAW264.7 cells. Food Science & Nutrition 9(11): 6162-6175.
    Pubmed KoreaMed CrossRef
  17. Settipane RA, Kaliner MA (2013) Chapter 14: Nonallergic rhinitis. American Journal of Rhinology & Allergy 27 (Suppl 1): S48-S51.
    CrossRef
  18. Varshney J, Varshney H (2015) Allergic Rhinitis: an Overview. Indian journal of otolaryngology and head and neck surgery. Official Publication of the Association of Otolaryngologists of India 67(2): 143-149.
    Pubmed KoreaMed CrossRef
  19. Wall EA, Zavzavadjian JR, Chang MS, Randhawa B, Zhu X, Hsueh RC, Liu J, Driver A, Bao XR, Sternweis PC, Simon MI, Fraser ID (2009) Suppression of LPS-induced TNF-alpha production in macrophages by cAMP is mediated by PKA-AKAP95-p105. Science Signaling 2(75): ra28.
    Pubmed KoreaMed CrossRef
  20. Wang K, Ping S, Huang S, Hu L, Xuan H, Zhang C, Hu F (2013) Molecular mechanisms underlying the in vitro anti-inflammatory effects of a flavonoid-rich ethanol extract from chinese propolis (poplar type). Evidence-based Complementary and Alternative Medicine 2013: 127672.
    Pubmed KoreaMed CrossRef
  21. Wang MJ, Kuo JS, Lee WW, Huang HY, Chen WF, Lin SZ (2006) Translational event mediates differential production of tumor necrosis factor-alpha in hyaluronan-stimulated microglia and macrophages. Journal of Neurochemistry 97(3): 857-871.
    Pubmed CrossRef
  22. Wang S, Cao M, Xu S, Shi J, Mao X, Yao X, Liu C (2020) Luteolin alters macrophage polarization to inhibit inflammation. Inflammation 43(1): 95-108.
    Pubmed CrossRef
  23. Wang W, Wu Y, Xu H, Shang Y, Chen Y, Yan M, Li Z, Walt DR (2019) Accumulation mechanism of indigo and indirubin in Polygonum tinctorium revealed by metabolite and transcriptome analysis. Industrial Crops and Products 141: 111783.
    CrossRef
  24. Wheeler KC, Jena MK, Pradhan BS, Nayak N, Das S, Hsu CD, Wheeler DS, Chen K, Nayak NR (2018) VEGF may contribute to macrophage recruitment and M2 polarization in the decidua. PloS One 13(1): e0191040.
    Pubmed KoreaMed CrossRef


April 2024, 68 (2)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)