search for




 

Ameliorating Effect of Lespedeza cuneata Extract on Male Menopause in Wistar Rats by Increasing Androgen Receptor
Yakhak Hoeji 2022;66(6):316-323
Published online December 31, 2022
© 2022 The Pharmaceutical Society of Korea.

Lee Seong*, Se-Young Choung**, Changhee Kim***, Hyung Jee Kim****, SangJoon Mo*****, Sun-Hyang Choi******, Eun Young Kim*******, Dahye Kang***, Eun Jin Kim***, and Jin Chul Ahn*****,#

*Research Institute of Clinical Medicine, Dankook University Hospital
**College of Pharmacy, Dankook University
***R&D Center, Naturalway Co., Ltd.
****Department of Urology, Dankook University College of Medicine
*****Medical Laser Research Center, Dankook University
******Center for Bio-Medical Engineering Core Facility, Dankook University
*******Beckman Laser Institute Korea, Dankook University
Correspondence to: Jin Chul Ahn, Medical Laser Research Center, Dankook University, 119, Dandae-ro, Dongnam-gu, Cheonan-si, Chungnam, 31116, Republic of Korea
Tel: +82-41-550-1780, Fax: +82-41-559-7838
E-mail: jcahn@dankook.ac.kr
Received October 26, 2022; Revised November 14, 2022; Accepted November 14, 2022.
Abstract
Male menopause, also referred to as late-onset hypogonadism or andropause, is a clinical syndrome characterized by sexual dysfunction, depressive disorder, and insomnia secondary to a testosterone deficiency in older men. Lespedeza cuneata, which belongs to the Fabaceae family, possesses several biological properties, including antiinflammatory, anti-oxidant, and antidiabetic effects. We investigated the inhibitory effect of standardized L. cuneata extract (LCE) on andropause symptoms in vivo. LCE administration significantly increased serum levels of total testosterone without any effects on serum estrogen levels. Additionally, LCE significantly increased serum 17-beta hydroxysteroid dehydrogenase 13 protein levels and reduced levels of sex hormone-binding globulin (SHBG), a protein that blocks free testosterone movement into the cytosol. LCE significantly upregulated the expression of cAMP response element binding protein and androgen receptor (AR), which functions as a transcription factor to stimulate spermatogenesis-associated genes and results in increased numbers of AR-positive cells, such as Leydig and Sertoli cells in the testis. To summarize, LCE administration increases serum testosterone, reduces SHBG levels and upregulates AR expression. Therefore, LCE may be useful as alternative therapy for andropause in older men.
Keywords : Androgen receptor, Andropause, Male menopause, Lespedeza cuneata, Testosterone
서 론(Introduction)

성 호르몬의 감소에 의해 유발되는 갱년기 증상은 신체 노화가 진행됨에 따라 점점 뚜렷하게 나타난다.1) 에스트로겐(estrogen)에 의한 여성 갱년기처럼 남성 갱년기(male menopause)는 테스토스테론(testosterone)의 감소가 주된 원인으로, 이로 인한 내분비계의 비정상적 변화로부터 기인된다.2) 여성 고령층은 성기능의 급격한 감소, 안면 홍조 등과 같이 여성 갱년기 증상을 뚜렷하게 경험하는 반면, 남성 고령층은 남성 갱년기로 인한 성욕감퇴, 성기능 저하, 피로감, 우울증 등의 증상을 노화가 진행됨에 따라 서서히 경험한다.2-4) 남성 갱년기 증상은 테스토스테론의 감소와 밀접한 연관성이 있어 성기능 저하에 국한되지 않고, 근육량과 골 미네랄 감소 및 비정상적 지방대사 조절 등 다른 기관에도 영향을 미친다.2,5) 한편, 국내외 고령인구가 증가함에 따라 갱년기에 의한 불편함을 호소하는 고령층 인구가 증가하여 이로 인한 사회적 이슈가 대두될 것으로 판단된다.6)

남성 갱년기의 주된 원인은 노화로 인한 테스토스테론의 감소이다.4) 테스토스테론은 고환(testis) 내 Leydig 세포에 존재하는 안드로겐 수용체(androgen receptor; AR)의 리간드(ligand)로 작용한다. 혈액 내의 유리 테스토스테론(free testosterone)이 Leydig 세포 안으로 이동하여 AR에 결합하면, AR은 핵 내로 전좌(translocation)되어 세포증식(proliferation), 정자 형성(spermatosis) 등에 관여하는 유전자의 발현을 조절한다.7,8) 이러한 테스토스테론에 의한 세포신호전달이 규명됨에 따라 경구 섭취나 혈액 및 근육 주사 등을 통한 테스토스테론 보충 요법이 남성 갱년기 증상 완화 또는 치료제로써 제시되고 있지만, 전립선 암, 전립선비대증(benign prostatic hyperplasia), 수면 무호흡 등의 부작용 및 안전성에 대한 논란이 지속되고 있어 사용에 주의를 요하고 있다.4) 테스토스테론 보충 요법 외에 AR에 효능제(agonist)로써 작용할 수 있는 선택적 안드로겐 수용체 조절인자(selective androgen receptor modulators)가 개발되고 있으나, 현재까지 미국 식품의 약국(U. S. Food and Drug Administration)에 승인된 약물이 없으며 개발되고 있는 치료제 또한 기능성 및 안전성 등에 대한 많은 검증이 요구되고 있다.9) 따라서, 남성 갱년기 증상 완화를 위해 보다 안전하고 쉽게 접근할 수 있는 천연물 소재를 이용한 치료법이 연구 및 개발되고 있다.10-12)

야관문이라 불리는 비수리(Lespedeza cuneata)는 콩과(Fabaceae)에 속하는 여러해살이 식물로 한국, 일본, 중국 등 아시아 지역에서 분포되어 있으며, 전통적으로 기침, 천식 등의 치료로 사용되어 왔다.13) 현재까지 비수리 추출물의 항광노화(anti-photoaging), 항염(anti-inflammation), 항산화(anti-oxidation), 항당뇨(anti-diabetes)등의 생리활성기능이 보고되었다.14-17) 또한, 비수리 추출물은 bisphenol A에 의해 유도된 고환 기능 장애(testicular dysfunction)로부터 고환을 보호하는 효과와 전립선 비대증을 억제하는 효과를 지녔다.18,19) Lee 등(2015)와 Park 등(2018)은 비수리 추출물과 호로파 종자추출물의 복합물이 40세 이상의 남성과 수컷 흰쥐에서 남성갱년기 증상을 완화하였음을 발표하였다.2,20) 추가적으로, 비수리 단독 추출물은 테스토스테론의 합성 촉진과 분해 억제 기전을 통해 총 테스토스테론(total testosterone)의 증가와 nitric oxide (NO)/cyclic guanosine monophosphate (cGMP) 세포신호전달의 활성 촉진을 통해 남성 갱년기를 억제하였다.3,21,22) 그러나, 현재까지 AR 조절을 통한 비수리 추출물의 남성 갱년기 개선 효과에 대해서는 규명된 바가 없다. 본 연구에서는 수컷 흰쥐(rats)를 이용하여 표준화된 비수리 추출물(Lespedeza cuneata extract; LCE)의 AR의 조절을 통한 남성 갱년기 효과를 검증하였다.

방 법(Methods)

시료 제조 및 표준화

본 실험에서 사용한 비수리 추출물의 제조방법은 Byun과 Choung(2019)이 제시한 방법에 따라 수행하였다.3) 간략하게, 강화도 인제에서 채취한 비수리의 잎과 줄기를 건조 및 파쇄한 후, 95±5°C에서 정제수로 추출, 여과 및 농축의 과정을 진행하였다. 농축물에 덱스트린을 혼합 후, 분무건조하여 LCE를 만들었다.

LCE의 지표 성분인 d-pinitol의 함량을 측정하기 위하여 고성능 액체크로마토그래피(high-performance liquid chromatography; HPLC) 분석을 진행하였다. 분석을 위해서 Agilent 1260 infinity HPLC system (Agilent, Palo Alto, CA, USA)을 사용했으며 검출기로 Alltech 3300 ELSD (Alltech, Columbia, MD, USA)를 사용했다. 분석을 위해서 Shodex Asahipak NH2p-50 4E column(250×4.6 mm, 5 μm; Shodex, Tokyo, Japan)을 이용하였다. 이동상은 85% acetonitrile으로 구성하였으며, 유속은 0.8 mL/min, 시료 주입량은 5 μL로 설정하였다. LCE 내 d-pinitol 함량 분석을 위해서 Biofron (La Mirada, CA, USA)에서 구입한 d-pinitol을 이용하여 standard curve를 구하였다. 분석 결과 LCE 내의 dpinitol의 함량은 약 8.8%로 확인되었다.

실험동물

생후 36주령된 수컷 Wistar 흰쥐 총 30마리를 Janvier Labs (Le Genest St. Isle, France)에서 구입하여 사용하였다. 실험동물은 온도 24°C, 상대습도 50±10%, 환기 회수 10-20회/시간, 조명 시간 12시간의 환경 하에서 cage당 두 마리씩 배치하여 사육하였다. 1주일간 적응시킨 후, 실험동물을 각각 10마리씩 무작위적으로 대조군(CON), LCE 150 mg/kg/day 투여군(LCE150), LCE 300 mg/kg/day 투여군(LCE300)으로 분류하였다. LCE는 1일 1회 같은 시간대에 4주간 경구 투여하였고, 동시에 동일한 양의 생리식염수를 CON군에 투여하였다. 경구 기간동안 1주일에 1회 실험동물의 체중을 측정하였다. 경구 투여 기간이 끝난 다음날, 10 mg/kg zoletil (Virbac, Carros, France)와 5mg/kg rompun (Bayer, Ansan, Republic of Korea)를 복강 내 주사하여 실험동물을 마취시켰다. 마취가 된 것을 육안으로 확인한 뒤, 실험동물의 하복부를 절개하여 복부대동맥에서 혈액을 채취하였고 고환을 회수하였다.

본 실험은 단국대학교 실험동물윤리위원회 승인 하에 표준작업 지침에 따라 수행되었다(DKU-22-043).

혈액 내 총 테스토스테론, 17β-HSD13, 에스트로겐, SHBG 농도 측정

혈액학적 지표를 평가하기 위해 혈액으로부터 원심분리하여 혈청을 채취하였다. 혈액 내 17-beta hydroxysteroid dehydrogenases 13 (17β-HSD13) 농도는 Mybioscience (Beverly, MA, USA)에서 구입한 enzyme-linked immunosorbent assay (ELISA) 키트를 사용하여 분석하였다. 총 테스토스테론(total testosterone) 농도는 Enzo Life Sciences (Farmingdale, NY, USA)에서 구입한 ELISA 키트를 사용하여 분석하였다. 에스트로겐과 sex hormonebinding globulin (SHBG) 농도는 LSbio (Seattle, WA, USA)에서 구입한 ELISA 키트를 사용하여 분석하였다. 각 분석 방법은 제조업체가 제공한 방법에 따라 측정하였다.

면역조직화학적 분석

실험동물에서 적출한 고환을 4% 포르말린에 보관한 후 파라핀 블록을 제작하였다. 파리핀 처리한 조직을 탈 파라핀화 후, unmasking solution (Thermo Fisher Scientific, 도시, MA, USA)에 슬라이드를 담그고 95~98°C에서 15분간 가열한 뒤, 슬라이드를 식혔다. 슬라이드를 tris buffered saline with Tween 20(TBST) 완충용액으로 세척 후, 실온에서 60분 동안 5% 소혈청 알부민(bovine serum albumin)으로 블로킹한 후 1:500으로 희석한 estrogen receptor beta (ERβ)와 AR 항체(Abcam, Cambridge, UK)와 슬라이드를 4°C에서 16시간 반응시켰다. TBS 완충용액으로 3번 세척한 후, 1:500으로 희석한 horse anti-rabbit IgG antibody (Vector Laboratories, Newark, CA, USA)와 함께 1시간 동안 인큐베이션 하였다. 면역염색은 ABC-HRP kit (Vector Laboratories)와 3,3'-diaminobenzidine (DAB; Vector Laboratories)을 사용하였으며, 무작위로 여러 위치를 측정하여 분석하였다.

Real-time Polymerase Chain Reaction (qRT-PCR)

실험동물에서 적출한 고환으로부터 Hybrid-R Kit (GeneAll Biotechnology, Seoul, Republic of Korea)를 이용하여 총 RNA를 추출하였다. 추출된 총 RNA의 양과 질을 NanoDrop 분광광도계(ND-1000; Nano Drop, Wilmington, DE, USA)를 사용하여 측정하였다. 추출한 총 RNA를 가지고 HyperScript™ 2X RT-Master mix Kit (GeneAll Biotechnology, Seoul, Republic of Korea)를 이용하여 역전사반응을 진행하여 cDNA를 합성하였다. 역전사 반응은 1 μg 총 RNA, 50 pmole/μL oligo dT primer, 2X RT Master mix (GeneAll Biotechnology, Seoul, Republic of Korea)로 이루어진 20 μL의 용액을 50°C에서 30분간의 반응 조건에서 진행하였으며, 반응 후, reverse transcriptase를 85°C에서 5분간 불활성화시킨 후, −20°C에서 보관하였다. qRT-PCR은 CFX ConnectTM Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA)에서 2X Multi-Star OneStep qRT-PCR Master Mix(BioFACT, Daejeon, Republic of Korea)를 사용하여 진행하였다. 사용된 primers (Bioneer, Daejeon, Republic of Korea)의 염기서열은 Table 1에 나타냈었다. 형광 측정은 cycle마다 측정되었으며, 유전자 발현에 대한 상대적인 정량은 delta-delta Ct 방법을 이용하여 측정하였다. 모든 반응은 GAPDH로 보정하였다.

Primer sequences used in qRT-PCR

Gene Direction Sequence (5'-3')
AR Forward
Reverse
CCATGGGGTTGGGTGTGGAA
TCCCAGAGCTACCTGCTTC
CBP Forward
Reverse
GCCTTCTCAATAGTAACTCTG
CCGTATTCAGTCCAGCATGG
NF-κB Forward
Reverse
CATTAGCCAGCGCATCCAGACCAA
AGAGTTCCGGTTTACTCGGCAGAT
GAPDH Forward
Reverse
GGCAAGTTCAACGGCACAG
CGCCAGTAGACTCCACGAC


통계분석

모든 분석 자료는 평균±표준오차(mean±SE)로 나타냈으며 실험결과 분석은 SPSS 25.0 (SPSS Inc., Chicago, IL, USA)를 사용하여 실시하였다. 각 처리군 간의 유의성 평가는 일원배치분산분석(one-way analysis of variance)으로 비교한 후, Duncan’s multiple range test를 이용하여 군 간의 유의성을 p<0.05과 p<0.01 수준에서 사후 확인하였다.

결 과(Results)

LCE가 흰쥐의 체중에 미치는 효과

경구투여 기간 동안, LCE가 흰쥐의 체중에 미치는 효과를 확인하였다. 4주 간의 경구투여 기간 내 군간의 뚜렷한 체중 변화가 나타나지 않았다(Fig. 1).



Fig. 1. Effect of LCE on body weight. Wistar rats were orally administered LCE at 150 and 300 mg/kg/day for 4 weeks. The body weight was measured per weeks for 4 weeks.

LCE가 총 테스토스테론과 에스트로겐 농도에 미치는 효과

LCE의 섭취가 테스토스테론과 에스트로겐의 농도에 미치는 영향을 확인하기 위하여 실험동물로부터 수득한 혈청 내 총 테스토스테론과 에스트론겐의 농도를 ELISA 방법으로 측정하였다(Fig. 2). LCE150군과 LCE300군에서 CON군과 비교하여 총 테스토스테론의 농도가 각각 11.42%와 21.41%씩 농도의존적(dose-dependent)으로 증가하였다. CON군과 비교하여 LCE150군에서는 통계적인 유의한 결과를 얻지 못했으나, LCE300군에서는 총 테스토스테론의 증가에 있어 유의한 효과가 있음을 확인하였다(p<0.05). 혈중 에스트로겐 농도는 각 군간의 뚜렷한 변화가 나타나지 않았다. 총 테스토스테론과 에스트로겐의 실험데이터를 기반으로 에스트로겐 대비 테스토스테론의 비율을 확인하였다. 총 테스토스테론의 결과와 비슷한 경향으로 에스트로겐 대비 테스토스테론의 비율이 농도 의존적으로 증가함을 확인하였으며, LCE300군에서만 CON군과 비교하여 유의성이 나타났다(p<0.05).



Fig. 2. Effects of LCE on total testosterone, estrogen, and ratio of total testosterone to estrogen. Wistar rats were orally administered LCE at 150 and 300 mg/kg/day for 4 weeks. (A) Total testosterone and (B) estrogen levels in serum were analyzed by ELISA. The ratio of (C) total testosterone to estrogen was calculated by the results of total testosterone and estrogen levels. Results are presented as the mean ± standard deviation. *p< 0.05 vs. CON group.

LCE가 17β-HSD13과 SHBG 농도에 미치는 효과

총 테스토스테론과 에스트로겐 농도 외에 혈중에서 추가적으로 17β-HSD13과 SHBG의 농도를 ELISA 분석법을 통하여 측정하였다(Fig. 3). 실험 결과, CON군과 비교하여 LCE를 150 mg/kg/day로 처리할 경우 17β-HSD13의 농도가 4.31% 감소하였으나 유의한 차이는 보이지 않았다. 반면, LCE를 300 mg/kg/day로 처리할 경우, 17β-HSD13의 농도가 대조군 대비 9.3% 감소하였으며 통계적으로 유의한 차이를 나타냈다(p<0.05). LCE를 150 mg/kg/day로 처리할 경우, CON군과 비교하여 SHBG의 혈중 농도에는 큰 변화가 없었으나, 300 mg/kg/day로 처리시 CON과 비교하여 10.77% 증가하였으며, 통계적으로 유의한 효과가 나타났다(p<0.05).



Fig. 3. Effects of LCE on 17β-HSD13 and SHBG. Wistar rats were orally administered LCE at 150 and 300 mg/kg/day for 4 weeks. (A) 17β-HSD13 and (B) SHBG levels in serum were analyzed by ELISA. Results are presented as the mean ± standard deviation. *p< 0.05 vs. CON group.

LCE가 AR과 ERβ의 발현과 AR과 ERβ을 지닌 세포의 수에 미치는 효과

LCE가 AR과 ERβ에 미치는 효과를 확인하기 위하여 면역조직 화학적 분석을 수행하였다(Fig. 4). 실험 결과 LCE 처리군에서 CON군과 비교하여 AR의 발현이 증가한 것을 확인할 수 있었으나, ERβ의 발현에 있어서는 뚜렷한 차이를 보이지 않았다. 추가적으로 AR이 염색된 세포의 수를 확인한 결과, CON군과 비교하여 LCE150군과 LCE300군에서 각각 28.99%와 31.44%씩 농도 의존적으로 유의하게 증가하는 것을 확인하였다(p<0.01). Erβ가 염색된 세포의 수에 대해서는 모든 군에서 차이를 보이지 않았다.



Fig. 4. Effects of LCE on AR and ERβ expression and the numbers of AR- and ER-positive cells. Wistar rats were orally administered LCE at 150 and 300 mg/kg/day for 4 weeks. The expression of (A) androgen receptor and (B) estrogen receptor beta in testis was analyzed by immunohistochemistry (magnification, ×400). Red arrow is Leydig cells and Blue arrow is Sertoli cells. From the images of immunohistochemistry, the numbers of cells with (C) AR and (D) ERβ in testis tissues were counted. Results are presented as the mean ± standard deviation. **p< 0.01 vs. CON group.

LCE가 AR, CBP와 NF-κB의 발현에 미치는 효과

LCE가 AR, cAMP response element (CRE) binding protein (CBP) 및 nuclear factor kappa B (NF-κB)의 발현에 미치는 효과를 확인하기 위하여 고환 조직으로부터 분리한 총 RNA를 이용하여 qRT-PCR을 진행하였다(Fig. 5). CON군과 비교하여 AR의 mRNA의 발현은 농도 의존적으로 모든 군에서 유의한 수준으로 증가하였다. CBP의 mRNA 발현량 또한 CON군과 비교하여 유의한 수준으로 증가하였다. 그러나, NF-κB의 mRNA 발현량의 경우, CON군과 비교하여 LCE 처리시 증가하는 경향은 보였으나, 유의한 수준의 결과는 도출되지 않았다.



Fig. 5. Effect of LCE on AR, CBP, and NF-κB expression. Wistar rats were orally administered LCE at 150 and 300 mg/kg/day for 4 weeks. The mRNA expression of AR, CBP, and NF-κB in testis was analyzed by qRT-PCR. Results are presented as the mean ± standard deviation. *p< 0.05, **p< 0.01 vs. CON group.
고 찰(Discussion)

기억력 감퇴, 우울증, 성 기능 저하, 발기부전, 성욕저하증 등의 증상을 동반한 남성 갱년기는 30대 이후 매년 1%씩 감소하는 테스토스테론의 농도 저하로 인해 야기된다.3,23) 본 연구진에서는 무작위(randomized), 이중맹검(double-blind), 위약 대조(placebo-control)로 설계한 인체적용시험에서 LCE의 1.25 g/day의 섭취가 androgen deficiency in aging males (ADAM)과 aging males’ symptoms (AMS) 설문 조사에서 총점을 유의한 수준으로 개선함으로써 남성 갱년기 증상을 완화시키는 효과가 있음을 확인하였다(unpublished). Shin 등(2010)이 언급한 방법에 따라 인체 적용시험의 섭취 농도를 동물실험의 투여 농도로 환산하였다.24) 성인 60 kg 기준 섭취량 1.25 g/day를 흰쥐의 경구투여 농도로 환산 시 150 mg/kg/day로 계산되었으며, 본 연구에서 150과 300 mg/kg/day의 농도로 LCE를 36주령 Wistar 수컷 흰쥐에 경구 투여하여 AR조절에 의한 남성 갱년기 개선 효과를 확인하였다.

테스토스테론의 합성 과정의 마지막 단계 작용하는 핵심 효소인 17β-HSD은 nicotinamide adenine dinucleotide phosphate(NADPH)를 조효소로 사용함으로써 androstenedione을 테스토스테론으로 전환하는 역할을 한다.25) 비수리 추출물은 과산화수소(H2O2)가 처리된 마우스 유래 Leydig 세포인 TM3 세포와 수컷 노화쥐로부터 적출한 정소 조직에서 17β-HSD3의 mRNA 발현량을 각각 유의한 수준으로 증가시켰다.3,22) Mo 등(2021)은 흰쥐에 비수리 추출물을 경구투여 함에 따라 혈중 17β-HSD3의 단백질 농도가 유의한 수준으로 증가하는 것을 확인하였다.21) 17β-HSD3 외에도 17β-HSD5와 17β-HSD13 등이 테스토스테론의 생성에 관여한다.26) 본 연구에서는 LCE의 투여로 17β-HSD13 혈중 단백질 농도와 총 테스토스테론의 농도가 각각 증가하였다. 이는 LCE가 androstenedione을 테스토스테론으로 전환하여 혈중총 테스토스테론의 농도를 증가시키는 17β-HSD13을 조절하는 것으로 판단된다.

테스토스테론에 결합하여 테스토스테론을 비활성을 하는 데 작용하는 SHBG 단백질은 테스토스테론이 세포질 안으로 이동하는 것을 방해하여 AR에 의해 조절되는 하위 세포 기작(downstream pathway)을 비활성화한다.8) SHBG 단백질 농도의 변화가 총 테스토스테론의 농도 변화를 의미하는 것은 아니지만, SHBG가 유리 테스토스테론의 농도를 감소시키기 때문에 SHBG의 조절은 남성 갱년기 개선에 있어 중요한 역할을 하는 생체지표이다.8,23) 본 연구에서는 LCE를 투여함에 따라 농도의존적으로 SHBG의 혈중 농도가 감소함을 확인하였으며, 특히, 고용량에서 유의한 효과가 있음을 확인하였다. 이전 연구에서도 비수리 추출물을 경구 투여 시 혈중 SHBG의 농도가 감소하였으며, 이로 인해 유리 테스토스테론의 증가와 총 테스토스테론 대비 유리 테스토스테론의 비율이 증가하는 것도 검증하였다.3) 또한, 남성 전립선 개선에 효과가 있는 쏘팔메토추출물도 SHBG의 단백질 생성을 억제하고 유리 테스토스테론을 증가시켜 남성 갱년기 증상을 완화시켰다.27) 따라서, 본 연구에서 LCE의 처리에 의한 SHBG의 감소는 유리 테스토스테론의 증가를 촉진함으로써 남성 갱년기 개선 효과를 가져오는 것으로 사료된다.

AR은 안드로겐(androgen)을 리간드로 하는 핵 수용체(nuclear receptor)로서, 테스토스테론, dihydrotestosterone (DHT)와 같은 안드로겐 호르몬과 결합시 세포질에서 핵 내로 이동하여 핵 내의 ARE promoter를 지닌 유전자에 결합하여 유전자의 발현을 조절한다.28) AR에 의해 조절되는 유전자에는 plasma membrane calcium ATPase 4 (PMCA4), emopamil binding protein (Ebp) 등이 있으며, 이들 유전자의 발현 조절을 통해 정자 생성 등의 활성이 나타난다.7,29) 남성 갱년기와 AR 유전자는 매우 밀접하게 연관되어 있음이 임상학적으로 밝혀졌으며, AR 유전자의 역할의 중요성이 강조되고 있다.30) Shi 등(2008)은 젊은 쥐와 비교하여 노화쥐에서 AR의 발현이 현저하게 감소되어 있음을 발표한 바 있다.31) Choi 등(2019)은 실험동물에서 산수유 등 함유 복합추출물이 AR 발현량을 조절하여 남성 갱년기 증상이 개선함을 보고하였다.32) 천연물 추출물의 남성 갱년기 개선에 관한 다수의 논문에서도 AR 발현량의 증가를 기전으로 제시하고 있다.11,12) AR 유전자의 promoter에 작용하여 AR의 전사(transcription)을 조절하는 인자로는 CBP와 NF-κB 등이 있다.33) 본 연구에서 LCE의 경구 투여는 AR과 CBP mRNA 발현량을 증가시켰을 뿐만 아니라 정소 내 AR를 지닌 Leydig와 Sertoli 세포 수를 유의한 수준으로 증가시켰다. 따라서, LCE의 남성 갱년기 완화 효과는 CBP의 조절을 통한 AR의 발현이 증가된 Leydig와 Sertoli 세포부터 기인된 것으로 판단된다.

본 연구에서 LCE150군에서는 총 테스토스테론의 증가와 17β-HSD13과 SHBG의 감소 경향을 확인하였으나, 통계적인 유의한 결과를 얻지 못했다. LCE300 군에서는 모든 지표에서 대해서 유의한 효과를 확인할 수 있었다. 추가적으로, AR과 CBP의 발현량과 AR를 지닌 세포 수가 CON군과 비교하여 모든 군에서 유의한 수준으로 증가하였다. 종합적으로, LCE에 의한 남성갱년기 증상 개선에 있어서 300 mg/kg/day의 고용량에서는 테스토스테론의 합성 증가, SHBG의 감소, AR의 발현 증가에 의한 것으로 사료되는 반면, 150 mg/kg/day의 저용량에서는 AR의 발현증가에 의해 남성 갱년기가 개선된 것으로 판단된다. 저용량에서 AR 발현량의 증가는 인체적용시험에서 LCE의 일일섭취량 1.25 g의 남성 갱년기 완화 효능의 한 기전으로 제시될 수 있다.

결 론(Conclusion)

본 연구에서는 비수리 추출물(Lespedeza cuneata extract; LCE)의 androgen receptor (AR) 조절을 통한 남성 갱년기 개선 효능을 검증하였다. LCE는 17-beta hydroxysteroid dehydrogenase 13 protein (17β-HSD13)의 발현을 증가시켜 총 테스토스테론의 농도를 증가시켰으며, sex hormone-binding globulin (SHBG)의 단백질 농도를 감소시켰다. 추가적으로 LCE는 고환의 AR, cAMP response element (CRE) binding protein (CBP)의 mRNA 발현량을 증가시키고 Leydig와 Sertoli 세포 내에 AR의 발현량을 증가시켰다. 따라서 비수리 추출물은 AR의 증가를 통해 남성갱년기 증상을 개선시키는 것으로 판단된다.

Acknowledgments

본 연구는 ㈜네추럴웨이(Naturalway Co., Ltd.)에서 연구비를 지원받아 수행되었으며, 이에 감사의 인사를 드린다.

Conflict of Interest

모든 저자는 이해 상충을 가지고 있지 않음을 선언한다.

References
  1. Jung JI, Eun S, Lee JK, Seo YH, Bae MH, Kim R, Kim EJ (2022) Effect of Eurycoma longifolia extract on testosterone synthesis in TM3 leydig cells under oxidative stress. J Korean Soc Food Sci Nutr 51: 640-650.
    CrossRef
  2. Lee KS, Lee EK, Kim SY, Kim TH, Kim HP (2015) Effect of a mixed extract of fenugreek seeds and Lespedeza cuneata on testosterone deficiency syndrome. Korean J Food Sci Technol 47: 492-498.
    CrossRef
  3. Byun JH, Choung SY (2019) Effects of Lespedeza cuneate extracts on andropause symptoms and testosterone metabolism in aged rats. Yakhak Hoeji 63: 359-366.
    CrossRef
  4. Kim KM (2013) Late-onset hypogonadism. Korean J Fam Pract 3: 245-254.
  5. Park JS, You GD, Seo SM, Han SB, Hong JT, Han K (2013) Inhibition effect of testosterone metabolism of some natural products containing yacon and their ameliorative effect of benign prostatic hyperplasia symptom. Yakhak Hoeji 57: 241-249.
  6. Kim BM, Park CS (2019) Population ageing and labor productivity in Korea. J Northeast Asian Econ Stud 31: 41-75.
  7. Sun R, Liang H, Guo H, Wang Z, Deng Q (2021) PMCA4 gene expression is regulated by the androgen receptor in the mouse testis during spermatogenesis. Mol Med Rep 23: 152.
    Pubmed KoreaMed CrossRef
  8. Feldman BJ, Feldman D (2001) The development of androgenindependent prostate cancer. Nat Rev Cancer 1: 34-45.
    Pubmed CrossRef
  9. Christiansen AR, Lipshultz LI, Hotaling JM, Pastuszak AW (2020) Selective androgen receptor modulators: the future of androgen therapy?. Transl Androl Urol 9: S135-S148.
    Pubmed KoreaMed CrossRef
  10. Rhee YH, Yoo SW, Lee S, Chung PS (2019) Aqueous extract of Lespedeza cuneata improves male menopause by increase of nitric oxide and dihydrotestosterone. Food Sci Biotechnol 28: 253-260.
    Pubmed KoreaMed CrossRef
  11. Park SY, Ahn SH, Kim HH (2019) Effects of Fructus amomi Amari, Eucommiae cortex, Bombyx batryticatus extract on improving symptoms of late-onset hypogonadism. J Physiol & Pathol Korean Med 33: 89-101.
    CrossRef
  12. Jeong HC, Jeon SH, Guan Qun Z, Bashraheel F, Choi SW, Kim SJ, Kim SW (2020) Lycium chinense Mill improves hypogonadism via anti-oxidative stress and anti-apoptotic effect in old aged rat model. Aging Male 23: 287-296.
    Pubmed CrossRef
  13. Kim DI, Hong JH (2012) Optimization of ethanol extraction conditions for functional components from Lespedeza cuneata using response surface methodology. Korean J Food Cook Sci 28: 275-283.
    CrossRef
  14. Kim HJ, Kim KS, Kim DI (2012) Inhibitory effects of Lespedeza cuneata ethanol extract on ultraviolet-induced photo aging. J Korean Soc Food Sci Nutr 41: 1540-1545.
    CrossRef
  15. Lee H, Jung JY, Hwangbo M, Ku SK, Kim YW, Jee SY (2013) Anti-inflammatory effects of Lespedeza cuneata in vivo and in vitro. Korea J Herbology 28: 83-92.
    CrossRef
  16. Cho EJ, Ju HM, Jeong CH, Eom SH, Heo HJ, Kim DO (2011) Effect of phenolic extract of dry leaves of Lespedeza cuneata G. Don on antioxidant capacity and tyrosinase inhibition. Hortic Sci Technol 29: 358-365.
  17. Bhesh RS, Min SK, Takako Y, Dong YR (2014) Anti-oxidant and anti-diabetic activities of Lespedeza cuneata water extract. J Med Plant Res 8: 935-941.
    CrossRef
  18. Park B, Kwon JE, Cho SM, Kim CW, Lee DE, Koo YT, Lee SH, Lee HM, Kang SC (2018) Protective effect of Lespedeza cuneata ethanol extract on bisphenol A-induced testicular dysfunction in vivo and in vitro. Biomed Pharmacother 102: 76-85.
    Pubmed CrossRef
  19. Park BK, Kim CW, Kwon JE, Negi M, Koo YT, Lee SH, Baek DH, Noh YH, Kang SC (2019) Effects of Lespedeza Cuneata aqueous extract on testosterone-induced prostatic hyperplasia. Pharm Biol 57: 89-97.
    Pubmed KoreaMed CrossRef
  20. Park HJ, Lee KS, Lee EK, Park NC (2018) Efficacy and safety of a mixed extract of trigonella foenum-graecum seed and Lespedeza cuneata in the treatment of testosterone deficiency syndrome: a randomized, double-blind, placebo-controlled clinical trial. World J Mens Health 36: 230-238.
    Pubmed KoreaMed CrossRef
  21. Mo S, Kim EY, Choi SH, Lee S, Lee S, Ahn JC (2021) Sericea lespedeza (Lespedeza cuneata) whole plant extract enhances rat muscle mass and sperm production by increasing the activity of NO-cGMP pathway and serum testosterone. Trop J Pharm Res 20: 121-128.
    CrossRef
  22. Byun JH, Yoo SW, Lee KP, Choung SY (2019) Effects of Lespedeza cuneata extract on testosterone synthesis and degradation in TM3 cells. Yakhak Hoeji 63: 137-143.
    CrossRef
  23. Noh YH (2018) MR-10 enhances men's health by improving endogenous male sex hormone generation. J Med Food 21: 1288-1294.
    Pubmed KoreaMed CrossRef
  24. Shin JW, Seol IC, Son CG (2010) Interpretation of animal dose and human equivalent dose for drug development. J Korean Med 31: 1-7.
  25. Labrie F, Luu-The V, Lin SX, Claude L, Simard J, Breton R, Belanger A (1997) The key role of 17β-hydroxysteroid dehydrogenases in sex steroid biology. Steroids 62: 148-158.
    Pubmed CrossRef
  26. Audet-Walsh E, Bellemare J, Lacombe L, Fradet Y, Fradet V, Douville P, Cuillemette C, Levesque E (2012) The impact of germline genetic variations in hydroxysteroid (17-beta) dehydrogenases on prostate cancer outcomes after prostatectomy. Eur Urol 62: 88-96.
    Pubmed CrossRef
  27. Yun JM, Lee M, Kim D, Prasad KS, Eun S, Kim OK, Lee J (2021) Standardized saw palmetto extract directly and indirectly affects testosterone biosynthesis and spermatogenesis. J Med Food 24: 617-625.
    Pubmed CrossRef
  28. Lee II, Kuznik NC, Rottenberg JT, Brown M, Cato AC (2019). BAG1L: a promising therapeutic target for androgen receptordependent prostate cancer. J Mol Endocrinol 62: R289-R299.
    Pubmed CrossRef
  29. Mu X, Liu K, Kleymenova E, Sar M, Young SS, Gaido KW (2006) Gene expression profiling of androgen receptor antagonists in the rat fetal testis reveals few common gene targets. J Biochem Mol Toxicol 20: 7-17.
    Pubmed CrossRef
  30. Kim JW, Bae YD, Ahn ST, Kim JW, Kim JJ, Moon DG (2018) Androgen receptor CAG repeat length as a risk factor of lateonset hypogonadism in a Korean Male Population. Sex Med 6: 203-209.
    Pubmed KoreaMed CrossRef
  31. Shi L, Ko S, Kim S, Echchgadda I, Oh TS, Song CS, Chatterjee B (2008) Loss of androgen receptor in aging and oxidative stress through Myb protooncoprotein-regulated reciprocal chromatin dynamics of p53 and poly (ADP-ribose) polymerase PARP-1. J Biol Chem 283: 36474-36485.
    Pubmed KoreaMed CrossRef
  32. Choi SW, Jeon SH, Kwon EB, Zhu GQ, Lee KW, Choi JB, Jeong HC, Kim KS, Bae, SR, Bae WJ, Kim SJ, Cho HJ, H US, Hong SH, Hwang SY, Kim SW (2019) Effect of Korean herbal formula (modified Ojayeonjonghwan) on androgen receptor expression in an aging rat model of late onset hypogonadism. World J Mens Health 37: 105-112.
    Pubmed KoreaMed CrossRef
  33. Zhang L, Charron M, Wright WW, Chatterjee B, Song CS, Roy AK, Brown TR (2004) Nuclear factor-κB activates transcription of the androgen receptor gene in Sertoli cells isolated from testes of adult rats. Endocrinology 145: 781-789.
    Pubmed CrossRef


December 2022, 66 (6)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)